pDOC-K-glmS-mPlum
(Plasmid #158062)

• Purpose: Donor plasmid for insertion of mPlum and the constitutive acpP promoter into the S. Typhimurium chromosome. mPlum is in the forward orientation relative to the kanamycin resistance selectable marker
• Depositing Lab: Mark Webber
• Publication: Holden et al Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994.

Backbone

• Vector backbone: pDOC-K-glmS
• Backbone manufacturer: Addgene #158058
• Backbone size w/o insert (bp): 8079
• Total vector size (bp): 8858
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: monomeric plum fluoresecent protein
• Alt name: mPlum
• Species: Discosoma sp. (mushroom coral)
• Insert Size (bp): 681
• Promoter: acpP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: GTTGCAAATTTTTCAACATTT
• 3′ sequencing primer: CAGCGCCTGTCACAGCGCAC

Resource Information

• Supplemental Documents:
  • 113 - pDOC-K-glmS-mPlum.gb
• A portion of this plasmid was derived from a plasmid made by: Amplified from Addgene plasmid #54564

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry