pDOC-K-glmS-GFPrev
(Plasmid #158060)

• Purpose: Donor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable marker
• Depositing Lab: Mark Webber
• Publication: Holden et al Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994.

Backbone

• Vector backbone: pDOC-K-glmS
• Backbone manufacturer: Addgene #158058
• Backbone size w/o insert (bp): 8079
• Total vector size (bp): 8894
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Green Fluorescent Protein optimised for excitation with UV light
• Alt name: GFPuv
• Species: Synthetic; Aequorea victoria
• Insert Size (bp): 717
• Promoter: acpP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: GTTGCAAATTTTTCAACATTT
• 3′ sequencing primer: TTATTTGTAGAGCTCATCCATG

Resource Information

• Supplemental Documents:
  • 64 - pDOC-K-glmS-GFPrev.gb
• A portion of this plasmid was derived from a plasmid made by: Amplified from pZEP08 in Hautefort, I., Proença, M. J., and Hinton, J. C. (2003) Single-copy green fluorescent protein gene fusions allow accurate measurement of Salmonella gene expression in vitro and during infection of mammalian cells, Appl. Environ. Microbiol. 69, 7480-7491

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry