pDOC-K-glmS
(Plasmid #158058)

• Purpose: Donor plasmid for chromosomal integrations of any sequence at a locus downstream of the glmS gene in Enterobacteriaceae using kanamycin resistance as a selectable marker
• Depositing Lab: Mark Webber
• Publication: Holden et al Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994.

Backbone

• Vector backbone: pDOC-K
• Backbone size w/o insert (bp): 7233
• Total vector size (bp): 8099
• Vector type: Synthetic Biology
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: glmS homologous region 1
• Alt name: HR1
• Species: Salmonella enterica Ser. Typhimurium
• Insert Size (bp): 430

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRi (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CATGATTACGCCAAGCTCTAG
• 3′ sequencing primer: ACCGGTCCTAGGTACCCGGC

Gene/Insert 2

• Gene/Insert name: glmS homologous region 2 + MCS3
• Alt name: HR2
• Species: Salmonella enterica Ser. Typhimurium

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: AAGCTTTCGACAGACGG
• 3′ sequencing primer: GGGTTTTCCCAGTCACGACGT

Resource Information

• Supplemental Documents:
  • 63 - pDOC-K-glms.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry