PLX306 iCre tetO NICD rtTA
(Plasmid
#158049)
-
Purposelenti-viral construct with Cre recombinase and doxycycline inducible expression of mouse Notch intracellular domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonePLX306 iCre
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemouse Notch Intra Cellular Domain
-
Alt nameNICD
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2394
- Promoter tetO promoter
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tggaaaaggcgcaaccccaacccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLX306 iCre tetO NICD rtTA was a gift from Daniel Schramek (Addgene plasmid # 158049 ; http://n2t.net/addgene:158049 ; RRID:Addgene_158049) -
For your References section:
Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling. Loganathan SK, Schleicher K, Malik A, Quevedo R, Langille E, Teng K, Oh RH, Rathod B, Tsai R, Samavarchi-Tehrani P, Pugh TJ, Gingras AC, Schramek D. Science. 2020 Mar 13;367(6483):1264-1269. doi: 10.1126/science.aax0902. 10.1126/science.aax0902 PubMed 32165588