Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-Cre sgAdam10 v3
(Plasmid #158034)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158034 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pLKO-Cre stuffer v3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Adam10 sgRNA
  • gRNA/shRNA sequence
    Adam10
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Cre sgAdam10 v3 was a gift from Daniel Schramek (Addgene plasmid # 158034 ; http://n2t.net/addgene:158034 ; RRID:Addgene_158034)
  • For your References section:

    Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling. Loganathan SK, Schleicher K, Malik A, Quevedo R, Langille E, Teng K, Oh RH, Rathod B, Tsai R, Samavarchi-Tehrani P, Pugh TJ, Gingras AC, Schramek D. Science. 2020 Mar 13;367(6483):1264-1269. doi: 10.1126/science.aax0902. 10.1126/science.aax0902 PubMed 32165588