pLKO-Cre stuffer v4
(Plasmid
#158032)
-
Purpose(Empty Backbone) lenti-viral construct with Cre recombinase and U6 driven sgRNA casette with modified tracrRNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepLKO-Cre stuffer v3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Cre stuffer v4 was a gift from Daniel Schramek (Addgene plasmid # 158032 ; http://n2t.net/addgene:158032 ; RRID:Addgene_158032) -
For your References section:
Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling. Loganathan SK, Schleicher K, Malik A, Quevedo R, Langille E, Teng K, Oh RH, Rathod B, Tsai R, Samavarchi-Tehrani P, Pugh TJ, Gingras AC, Schramek D. Science. 2020 Mar 13;367(6483):1264-1269. doi: 10.1126/science.aax0902. 10.1126/science.aax0902 PubMed 32165588