pJL2-mGold-P2A-EBFP2
(Plasmid #157998)

• Purpose: Co-expression of mGold and EBFP2 in mammalian cells.
• Depositing Lab: Francois St-Pierre
• Publication: Lee et al Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct.

Backbone

• Vector backbone: pJL2
• Backbone size w/o insert (bp): 6992
• Total vector size (bp): 8507
• Vector type: Mammalian Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mGold-P2A-EBFP2
• Species: Synthetic
• Insert Size (bp): 1515
• Mutation: mGold is mVenus with L46F;T63S mutations
• GenBank ID:
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GGCAACTAGAAGGCACAGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A mammalian expression cassette was cloned into a yeast vector.
mGold: FPBaseID TBD
EBFP2: FPBaseID DVMQ7 Please note that the mVenus annotation in the plasmid map is incorrect, as this plasmid encodes mGold.