-
PurposeLentiviral vector of constitutive expression of mNeonGreen3A(1-10)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-SFFV
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 9642
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepSFFV_mNG3K(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)636
-
MutationW148L, M150V, K153M, N194K, F204L
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCTTCTGCTTCCCGAGCTCTA
- 3′ sequencing primer GCAGCGTATCCACATAGCGTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV_mNG3A(1-10) was a gift from Bo Huang (Addgene plasmid # 157992 ; http://n2t.net/addgene:157992 ; RRID:Addgene_157992) -
For your References section:
Improved yellow-green split fluorescent proteins for protein labeling and signal amplification. Zhou S, Feng S, Brown D, Huang B. PLoS One. 2020 Nov 23;15(11):e0242592. doi: 10.1371/journal.pone.0242592. eCollection 2020. 10.1371/journal.pone.0242592 PubMed 33227014