pTR-UF11
(Plasmid #157970)

• Purpose: AAV vector plasmid containing the Chimeric CMV/Chicken Beta Actin promoter driving 'humanized' GFP
• Depositing Lab: Sergei Zolotukhin
• Publication: Burger et al Mol Ther. 2004 Aug;10(2):302-17. doi: 10.1016/j.ymthe.2004.05.024.

Backbone

• Vector backbone: pUC
• Modifications to backbone: Contains AAV2 ITRs
• Vector type: AAV
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 'humanized' e.g. codon optimized GFP
• Alt name: hGFP
• Species: Synthetic
• Promoter: chimeric CMV/Chicken Beta actin (CBA)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: ACAGCTCCTGGGCAACGTGC
• 3′ sequencing primer: TGCATTCTAGTTGTGGTTTGTCC

Resource Information

• Supplemental Documents:
  • pTR-UF11.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Created By Sergei Zolotukhin at the University of Florida

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid may be prone to ITR instability. It is recommended to store the plasmid in an E. coli strain such as NEB stable and to verify by SmaI digest. See the Resource Information section for a digest from Addgene's stock.

Information for AAV2 in TMN200 (Catalog # 157970-AAV.A01.T)

Purpose

Ready-to-use AAV2 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
• Buffer: TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV2
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98193

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 in PBS (Catalog # 157970-AAV.A02.T)

Purpose

Ready-to-use AAV2 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 5×10¹¹ vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
• Buffer: PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV2
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98192

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.

Information for AAV2 in BSS (Catalog # 157970-AAV.A03.T)

Purpose

Ready-to-use AAV2 in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
• Buffer: BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV2
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98191

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2 (Y444F) in TMN200 (Catalog # 157970-AAV.A04.T)

Purpose

Ready-to-use AAV2 (Y444F) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2(Y444F) cap gene
• Buffer: TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV2(Y444F). The AAV2(Y444F) mutant is derived from AAV2 with the following mutation, Y444F.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98190

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 (Y444F) in BSS (Catalog # 157970-AAV.A05.T)

Purpose

Ready-to-use AAV2 (Y444F) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2(Y444F) cap gene
• Buffer: BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
• Serotype: AAV2(Y444F). The AAV2(Y444F) mutant is derived from AAV2 with the following mutation, Y444F.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98189

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2 (trpYF) in TMN200 (Catalog # 157970-AAV.A06.T)

Purpose

Ready-to-use AAV2 (trpYF) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 (trpYF) cap gene
• Buffer: TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV2 (trpYF). The AAV2 (trpYF) mutant is derived from the AAV2 capsid and contains the following mutations, Y444F, Y500F and Y730F.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98188

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV2 (trpYF) in BSS (Catalog # 157970-AAV.A07.T)

Purpose

Ready-to-use AAV2 (trpYF) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2 (trpYF) cap gene
• Buffer: BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
• Serotype: AAV2 (trpYF). The AAV2 (trpYF) mutant is derived from the AAV2 capsid and contains the following mutations, Y444F, Y500F and Y730F.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98187

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV2(4pMut)dHS in BSS (Catalog # 157970-AAV.A08.T)

Purpose

Ready-to-use AAV2(4pMut)dHS in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV2(4pMut)dHS cap gene
• Buffer: BSS supplemented with 0.001% pluronic F68 or 0.014% Tween 20.
• Serotype: AAV2(4pMut)dHS. The AAV2(4pMut)dHS serotype is derived from AAV2 with the following mutations, Y444F, Y500F, Y730F, T491V, R487G, R585S and R588T.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98186

Visit our viral production page for more information.

Addgene Comments

BSS is an ophthalmic solution suitable for any application.

Information for AAV6 in TMN200 (Catalog # 157970-AAV.A09.T)

Purpose

Ready-to-use AAV6 in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV6 cap gene
• Buffer: TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV6
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98197

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV6(dbY-F+T-V) in TMN200 (Catalog # 157970-AAV.A10.T)

Purpose

Ready-to-use AAV6(dbY-F+T-V) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV6(dbY-F+T-V) cap gene
• Buffer: TMN200 (200mM sodium chloride, 1mM magnesium chloride, 20mM Tris at pH 8.0) supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV6(dbY-F+T-V). The AAV6(dbY-F+T-V) serotype is derived from AAV6 and contains the following mutations, Y705F, Y731F and T492V.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98196

Visit our viral production page for more information.

Addgene Comments

TMN200 is a buffer optimized for maintaining AAV solubility. TMN200 is suitable for in vitro as well as in vivo delivery where the vector is diluted by the physiologic body fluids, such as blood, vitreous, CSF, etc. TMN200 is not suitable as a buffer for vectors delivered directly to the brain parenchyma or subretinal space.

Information for AAV44.9 in PBS (Catalog # 157970-AAV.A11.T)

Purpose

Ready-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV44.9 cap gene
• Buffer: PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV44.9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98195

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.

Information for AAV44.9(E531D) in PBS (Catalog # 157970-AAV.A12.T)

Purpose

Ready-to-use AAV44.9(E531D) in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA.

'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoter

Delivery

• Volume: 20 µL
• Titer: ≥ 1×10¹² vg/mL
• Pricing: $110 USD for preparation of 20 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV44.9(E531D) cap gene
• Buffer: PBS supplemented with 0.001% pluronic F68 or 0.014% Tween 20
• Serotype: AAV44.9(E531D). The AAV44.9(E531D) serotype is derived from AAV44.9 and contains the following mutation, E531D.
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Certificate of Analysis (CoA)

• Lot v98194

Visit our viral production page for more information.

Addgene Comments

PBS is a universal buffer suitable for any application.