Skip to main content
Addgene

Lenti-117G-hyA3A-BE4max
(Plasmid #157945)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157945 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti-117G- hyA3A-BE4max
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgcagacaaatggcagta
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-117G-hyA3A-BE4max was a gift from Dali Li (Addgene plasmid # 157945 ; http://n2t.net/addgene:157945 ; RRID:Addgene_157945)
  • For your References section:

    Increasing the efficiency and targeting range of cytidine base editors through fusion of a single-stranded DNA-binding protein domain. Zhang X, Chen L, Zhu B, Wang L, Chen C, Hong M, Huang Y, Li H, Han H, Cai B, Yu W, Yin S, Yang L, Yang Z, Liu M, Zhang Y, Mao Z, Wu Y, Liu M, Li D. Nat Cell Biol. 2020 Jun;22(6):740-750. doi: 10.1038/s41556-020-0518-8. Epub 2020 May 11. 10.1038/s41556-020-0518-8 PubMed 32393889