pPK-351
(Plasmid
#157921)
-
PurposepcDNA-CMV-PIF3MTAD-IRES-PhyBGal4DBD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression, Synthetic Biology ; Optogenetics
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Growth instructionsThis plasmid can grow slowly and have low yields but is more stable than pPK-230.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePIF3-MTAD
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)701
-
Mutationpif3 1-523
- Promoter CMV
-
Tag
/ Fusion Protein
- SV40NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer T7 promoter (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIRES
-
Alt nameInternal Ribosomal Entry Site
-
Insert Size (bp)583
Gene/Insert 3
-
Gene/Insert namePhyB(1-621)-SV40NLS-Gal4DBD
-
SpeciesS. cerevisiae (budding yeast), A. thaliana (mustard weed)
-
Insert Size (bp)2391
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer GACGTGGTTTTCCTTTGAAAAACAC
- 3′ sequencing primer SP6 promoter (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPK-351 was a gift from Phillip Kyriakakis (Addgene plasmid # 157921 ; http://n2t.net/addgene:157921 ; RRID:Addgene_157921) -
For your References section:
Building a Simple and Versatile Illumination System for Optogenetic Experiments. Kyriakakis P, Fernandez de Cossio L, Howard PW, Kouv S, Catanho M, Hu VJ, Kyriakakis R, Allen ME, Ma Y, Aguilar-Rivera M, Coleman TP. J Vis Exp. 2021 Jan 12;(167). doi: 10.3791/61914. 10.3791/61914 PubMed 33522514