pJDC124
(Plasmid #157877)

• Purpose: mCherry is expressed under the mycobacterial phsp60 heat shock promoter for in vivo and in vitro detection.
• Depositing Lab: Jeffrey Cirillo
• Publication: Kong et al PLoS One. 2016 Mar 2;11(3):e0149972. doi: 10.1371/journal.pone.0149972. eCollection 2016.

Backbone

• Vector backbone: pJDC89
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• Promoter: phsp60

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: ScaI (unknown if destroyed)
• 5′ sequencing primer: AGGAGGATAACATATGGAAGATGC
• 3′ sequencing primer: CAGCTTCGACTTGCCTCC

Resource Information

• Supplemental Documents:
  • phsp60-mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Rodger Y. Tsien

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry