pDendra2-H3
(Plasmid #157814)

• Purpose: Fluorescent reporter for histone H3 tracking
• Depositing Lab: Xin Chen
• Publication: Ma et al Cell Rep. 2020 Aug 11;32(6):108003. doi: 10.1016/j.celrep.2020.108003.

Backbone

• Vector backbone: Dendra2-N1
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 5117
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H3
• Alt name: Hist1h3a
• Species: M. musculus (mouse)
• Insert Size (bp): 408
• GenBank ID: 360198
• Entrez Gene: H3c1 (a.k.a. H3c10, H3c11, H3c8, Hist1h3a)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: N/A

Resource Information

• Supplemental Documents:
  • Chen lab histone-dendra2 plasmids instructions

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry