Skip to main content
Addgene

pWM_12x601_193 NRL + TetO
(Plasmid #157812)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157812 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pWM
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    12x601_tetO
  • Species
    Synthetic
  • Insert Size (bp)
    2954

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NaeI (not destroyed)
  • 5′ sequencing primer AGCCCGCTCATTAGGCGGGCTAC
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone a gift from Tom Muir & insert a gift from Sy Redding

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

occasional plasmid instability in dam-/dcm- strains
High copy plasmid (pUC-based, but medium yield)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWM_12x601_193 NRL + TetO was a gift from Michael Rosen (Addgene plasmid # 157812 ; http://n2t.net/addgene:157812 ; RRID:Addgene_157812)

  • For your References section:

    Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265
Related items:
Commonly requested with: