pET19b+H3
(Plasmid
#157807)
-
PurposeExpression of cysteine-free human histone H3 (c111A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET19b
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameH3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)425
-
MutationC111A
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET19b+H3 was a gift from Michael Rosen (Addgene plasmid # 157807 ; http://n2t.net/addgene:157807 ; RRID:Addgene_157807) -
For your References section:
Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265