Skip to main content
Addgene

pMTTH+mEGFP-LANA
(Plasmid #157801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157801 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    modified pMal (MTTH)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mEGFP-LANA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    846
  • Promoter pTAC
  • Tags / Fusion Proteins
    • MBP (N terminal on insert)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTTH+mEGFP-LANA was a gift from Michael Rosen (Addgene plasmid # 157801 ; http://n2t.net/addgene:157801 ; RRID:Addgene_157801)
  • For your References section:

    Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265