pETduet+sfGFP-TetR-p300HAT
(Plasmid #157795)

• Purpose: Expression of sfGFP-TetR-p300HAT fusion protein
• Depositing Lab: Michael Rosen
• Publication: Gibson et al Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19.

Backbone

• Vector backbone: pETduet
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sfGFP-TetR-p300
• Species: H. sapiens (human)
• Insert Size (bp): 4226
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: T7
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: promA(NcoI) promB(NdeI) (not destroyed)
• 3′ cloning site: promA(NotI) promB(XhoI) (not destroyed)
• 5′ sequencing primer: gtccggcgtagaggatcgagatcg, gtacacggccgcataatcgaaattaatacgactcac
• 3′ sequencing primer: gtgagtcgtattaatttcgattatgcggccgtgtac, ctgcgctagtagacgagtccatgtgc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ySIR2 required for expression & purification - A synthetic ORF encoding the histone deacetylase domain of S. cerevisiae protein SIR2 was amplified from a dsDNA synthesized by IDT using PCR and primers adding a 5'-proximal translation start codon and a 3'-proximal translation stop codon and XhoI restriction endonuclease recognition site. XhoI restriction endonuclease (NEB) digested PCR product encoding amino acids 87-562 of wild-type SIR2 was cloned into the pETduet-1 expression vector (Novagen) using a XhoI and a blunted NdeI restriction endonuclease digestion site (NEB).