49535-sgFMR1_E17A
(Plasmid
#157782)
-
PurposeExpresses a sgRNA targeting stop codon of human FMR1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAddgene #49535
- Backbone size w/o insert (bp) 13450
- Total vector size (bp) 11590
-
Modifications to backbonereplacing filler with sgRNA
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFMR1
-
gRNA/shRNA sequenceTAGGGTACTCCATTCACGAG
-
SpeciesH. sapiens (human)
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
49535-sgFMR1_E17A was a gift from Xinyu Zhao (Addgene plasmid # 157782 ; http://n2t.net/addgene:157782 ; RRID:Addgene_157782) -
For your References section:
Identification of FMR1-regulated molecular networks in human neurodevelopment. Li M, Shin J, Risgaard RD, Parries MJ, Wang J, Chasman D, Liu S, Roy S, Bhattacharyya A, Zhao X. Genome Res. 2020 Mar;30(3):361-374. doi: 10.1101/gr.251405.119. Epub 2020 Mar 16. 10.1101/gr.251405.119 PubMed 32179589