Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

49535-sgFMR1_E17A
(Plasmid #157782)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157782 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene #49535
  • Backbone size w/o insert (bp) 13450
  • Total vector size (bp) 11590
  • Modifications to backbone
    replacing filler with sgRNA
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FMR1
  • gRNA/shRNA sequence
    TAGGGTACTCCATTCACGAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    FMR1 (a.k.a. FMRP, FRAXA, POF, POF1)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    49535-sgFMR1_E17A was a gift from Xinyu Zhao (Addgene plasmid # 157782 ; http://n2t.net/addgene:157782 ; RRID:Addgene_157782)
  • For your References section:

    Identification of FMR1-regulated molecular networks in human neurodevelopment. Li M, Shin J, Risgaard RD, Parries MJ, Wang J, Chasman D, Liu S, Roy S, Bhattacharyya A, Zhao X. Genome Res. 2020 Mar;30(3):361-374. doi: 10.1101/gr.251405.119. Epub 2020 Mar 16. 10.1101/gr.251405.119 PubMed 32179589