Skip to main content
Addgene

pCMV superYFP-AURKA K162M-mTurq2
(Plasmid #157773)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157773 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6167
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AURKA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1223
  • Mutation
    AURKA K162M is a kinase-dead version of AURKA
  • Entrez Gene
    AURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
  • Promoter CMV
  • Tags / Fusion Proteins
    • superYFP (N terminal on insert)
    • mTurquoise2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pCMV
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV superYFP-AURKA K162M-mTurq2 was a gift from Marc Tramier (Addgene plasmid # 157773 ; http://n2t.net/addgene:157773 ; RRID:Addgene_157773)
  • For your References section:

    Aurora kinase A localises to mitochondria to control organelle dynamics and energy production. Bertolin G, Bulteau AL, Alves-Guerra MC, Burel A, Lavault MT, Gavard O, Le Bras S, Gagne JP, Poirier GG, Le Borgne R, Prigent C, Tramier M. eLife. 2018 Aug 2;7. pii: 38111. doi: 10.7554/eLife.38111. 10.7554/eLife.38111 PubMed 30070631