Skip to main content
Addgene

pCMV ShadowY-AURKA-mTurq2
(Plasmid #157770)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157770 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV mTurquoise2-shadowY tandem
  • Backbone manufacturer
    Tramier
  • Backbone size w/o insert (bp) 5415
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AURKA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1223
  • Entrez Gene
    AURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
  • Promoter CMV
  • Tags / Fusion Proteins
    • shadowY (N terminal on insert)
    • mTurquoise2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV ShadowY-AURKA-mTurq2 was a gift from Marc Tramier (Addgene plasmid # 157770 ; http://n2t.net/addgene:157770 ; RRID:Addgene_157770)

  • For your References section:

    Aurora kinase A localises to mitochondria to control organelle dynamics and energy production. Bertolin G, Bulteau AL, Alves-Guerra MC, Burel A, Lavault MT, Gavard O, Le Bras S, Gagne JP, Poirier GG, Le Borgne R, Prigent C, Tramier M. eLife. 2018 Aug 2;7. pii: 38111. doi: 10.7554/eLife.38111. 10.7554/eLife.38111 PubMed 30070631
Related items: