-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmGFPc1( modified from pEGFP-c1)
-
Backbone manufacturerGlick Lab
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec16S
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3183
-
MutationN/A
-
GenBank IDEF125213
-
Entrez GeneSEC16B (a.k.a. LZTR2, PGPR-p117, RGPR, RGPR-p117, SEC16S)
-
Tag
/ Fusion Protein
- mEGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ecl136II (destroyed during cloning)
- 3′ cloning site Ecl136II (destroyed during cloning)
- 5′ sequencing primer catggtcctgctggagttcgt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmGFP-Sec16S was a gift from Benjamin Glick (Addgene plasmid # 15775 ; http://n2t.net/addgene:15775 ; RRID:Addgene_15775) -
For your References section:
Two mammalian Sec16 homologues have nonredundant functions in endoplasmic reticulum (ER) export and transitional ER organization. Bhattacharyya D, Glick BS. Mol Biol Cell. 2007 Mar;18(3):839-49. doi: 10.1091/mbc.e06-08-0707 10.1091/mbc.e06-08-0707 PubMed 17192411