Skip to main content
Addgene

Plasmid EUPp_09
(Plasmid #157745)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157745 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PgyrA_pMB1_ampR
  • Backbone size w/o insert (bp) 2502
  • Total vector size (bp) 4952
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    acetaldehyde dehydrogenase
  • Alt name
    ada
  • Species
    Dickeya zeae
  • Insert Size (bp)
    1374
  • Promoter PgyrA

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ggaacactccgtgatcgaacc
  • 3′ sequencing primer Aggcaatacggaacatatcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    alcohol dehydrogenase
  • Alt name
    adh2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1041
  • GenBank ID
  • Entrez Gene
    ADH2 (a.k.a. YMR303C, ADR2)
  • Promoter PgyrA

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer Gtctattccagaaactcaaaa
  • 3′ sequencing primer Atttagaagtgtcaacaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Plasmid EUPp_09 was a gift from Kang Zhou (Addgene plasmid # 157745 ; http://n2t.net/addgene:157745 ; RRID:Addgene_157745)
  • For your References section:

    Constructing an ethanol utilization pathway in Escherichia coli to produce acetyl-CoA derived compounds. Liang H, Ma X, Ning W, Liu Y, Sinskey AJ, Stephanopoulos G, Zhou K. Metab Eng. 2020 Nov 25. pii: S1096-7176(20)30180-4. doi: 10.1016/j.ymben.2020.11.010. 10.1016/j.ymben.2020.11.010 PubMed 33248272