AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR
(Plasmid
#157744)
-
Purposeknock CLTX-NKG2D-2B4-CD3z CAR into AAVS1 safe harbor locus for constitutive expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1-Puro CAG FUCCI (Addgene #136934)
- Backbone size w/o insert (bp) 10229
- Total vector size (bp) 11867
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namechlorotoxin containing chimeric antigen receptor targeting glioblastoma
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1638
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer tctagagcctctgctaaccatgt
- 3′ sequencing primer M13 RVS (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that a mismatch was identified upstream and in frame with the insert, causing a Q>K mutation (location is at bps 3710-3712 of Addgene NGS Result). The depositing lab has noted that this change has no affect on plasmid function.
Please visit https://doi.org/10.1101/2022.03.02.482679 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR was a gift from Xiaoping Bao (Addgene plasmid # 157744 ; http://n2t.net/addgene:157744 ; RRID:Addgene_157744) -
For your References section:
Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy. Chang Y, Syahirah R, Wang X, Jin G, Torregrosa-Allen S, Elzey BD, Hummel SN, Wang T, Li C, Lian X, Deng Q, Broxmeyer HE, Bao X. Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128. 10.1016/j.celrep.2022.111128 PubMed 35858579