AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR
(Plasmid #157744)

• Purpose: knock CLTX-NKG2D-2B4-CD3z CAR into AAVS1 safe harbor locus for constitutive expression
• Depositing Lab: Xiaoping Bao
• Publication: Chang et al Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128.

Backbone

• Vector backbone: AAVS1-Puro CAG FUCCI (Addgene #136934)
• Backbone size w/o insert (bp): 10229
• Total vector size (bp): 11867
• Vector type: Mammalian Expression, CRISPR, TALEN, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: chlorotoxin containing chimeric antigen receptor targeting glioblastoma
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1638
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: tctagagcctctgctaaccatgt
• 3′ sequencing primer: M13 RVS

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that a mismatch was identified upstream and in frame with the insert, causing a Q>K mutation (location is at bps 3710-3712 of Addgene NGS Result). The depositing lab has noted that this change has no affect on plasmid function.

Please visit https://doi.org/10.1101/2022.03.02.482679 for bioRxiv preprint.