pFastBac1-His10FLAG
(Plasmid #157736)

• Purpose: (Empty Backbone) empty pFastBac1 vector (polyhedrin promoter) adds enterokinase-removable N-terminal His10-tag + 3xFLAG tag; avoids unwanted residues in the final protein sequence by using the BseRI restriction sites
• Depositing Lab: Debra Hansen
• Publication: Olson et al Protein Expr Purif. 2021 May 7:105890. doi: 10.1016/j.pep.2021.105890.

Backbone

• Vector backbone: pFastBac1
• Backbone manufacturer: Invitrogen
• Backbone size (bp): 4682
• Modifications to backbone: introduced a silent mutation in the gentamyin-resistance gene in order to remove one BseRI site
• Vector type: Insect Expression
• Promoter: polyhedrin
• Selectable markers: Gentamicin
• Tag / Fusion Protein:
  • His10 + 3xFLAG, enterokinase-cleavable (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAATGATAACCATCTCGC
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • pFastBac1-His10FLAG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

- This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following enterokinase cleavage of the N-terminal purification tags (His10 and 3xFLAG). Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, GATGACGATGACAAG, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer.
- The sequence of the N-terminus will be MGSS + His10 + DYKDHDGDYKDHDIDYKDDDDK*X, where * is the enterokinase cleavage site and X is the N-terminus of the protein of interest. For X residues that are compatible with enterokinase activity, see Hosfield & Lu 1999, PMID 10094769.
- BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone.
- An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene.
- To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG).
- To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC).
- To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.