pIND-miR30
(Plasmid
#15769)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneSee comments
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression, RNAi
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGT115 (InvivoGen)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR30
-
Insert Size (bp)114
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer GTGCCACCTGACGTCGACGGA
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Purpose: inducible vector for cloning shRNAs. This vector was created by replacing the CMV promoter of pcDNA6.2-GW (Invitrogen, V49351) with five copies of E/GRE repeats and a minimal pol II promoter (from pIND), followed by miR-30 sequence from pSM2 (Open Biosystems, EVA4679).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIND-miR30 was a gift from Danny Rangasamy (Addgene plasmid # 15769 ; http://n2t.net/addgene:15769 ; RRID:Addgene_15769)