pSCMV-H2B-FT-Medium
(Plasmid #157670)

• Purpose: Retroviral vector for expressing chimeric human histone H2B fused with the "Medium" variant of the monomeric color-changing fluorescent timer (FT) in mammalian cells.
• Depositing Lab: Shangqin Guo
• Publication: Eastman et al Cell Rep. 2020 Jun 23;31(12):107804. doi: 10.1016/j.celrep.2020.107804.

Backbone

• Vector backbone: pSCMV
• Backbone manufacturer: Guo et al. 2012 (PMC3478612)
• Backbone size w/o insert (bp): 7060
• Total vector size (bp): 8173
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Histone H2B
• Alt name: H2B
• Species: H. sapiens (human)
• Insert Size (bp): 1113
• Promoter: CMV
• Tag / Fusion Protein:
  • Medium-FT (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: attaatacgactcactatagggag
• 3′ sequencing primer: tgagggctggataaagggag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry