pTT3-SP-6xHis-NTRK1(FL)-FLAG
(Plasmid #157620)

• Purpose: Mammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assays
• Depositing Lab: Chris Garcia
• Publication: Wojtowicz et al Cell. 2020 Aug 20;182(4):1027-1043.e17. doi: 10.1016/j.cell.2020.07.025.

Backbone

• Vector backbone: pTT3
• Backbone size w/o insert (bp): 5982
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NTRK1
• Species: H. sapiens (human)
• Insert Size (bp): 2442
• Mutation:
• Entrez Gene: NTRK1 (a.k.a. MTC, TRK, TRK1, TRKA, Trk-A, p140-TrkA)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (C terminal on backbone)
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: GCGGCCGC (not destroyed)
• 3′ cloning site: ACGCGT (not destroyed)
• 5′ sequencing primer: TTGCCTTTCTCTCCACAGGT
• 3′ sequencing primer: CCCATATGTCCTTCCGAGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: synthesis by ThermoFisher

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.