Skip to main content
Addgene

pD649-HAsp-JAG2-Fc(DAPA)-AviTag-6xHis
(Plasmid #157027)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157027 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pD649
  • Backbone size w/o insert (bp) 6106
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JAG2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3162
  • Mutation
    Fc region of human IgG contains D265A and P329A mutations (DAPA)
  • Entrez Gene
    JAG2 (a.k.a. HJ2, SER2)
  • Promoter CMV/SP6
  • Tag / Fusion Protein
    • Fc(DAPA)-AviTag-6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site GCGGCCGC (not destroyed)
  • 3′ cloning site GGCGCGCC (not destroyed)
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer CACGTACCAGTTGAACTTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD649-HAsp-JAG2-Fc(DAPA)-AviTag-6xHis was a gift from Chris Garcia (Addgene plasmid # 157027 ; http://n2t.net/addgene:157027 ; RRID:Addgene_157027)
  • For your References section:

    A Human IgSF Cell-Surface Interactome Reveals a Complex Network of Protein-Protein Interactions. Wojtowicz WM, Vielmetter J, Fernandes RA, Siepe DH, Eastman CL, Chisholm GB, Cox S, Klock H, Anderson PW, Rue SM, Miller JJ, Glaser SM, Bragstad ML, Vance J, Lam AW, Lesley SA, Zinn K, Garcia KC. Cell. 2020 Aug 20;182(4):1027-1043.e17. doi: 10.1016/j.cell.2020.07.025. 10.1016/j.cell.2020.07.025 PubMed 32822567