Skip to main content
Addgene

pBABE YAP1
(Plasmid #15682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15682 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBABE puro
  • Backbone manufacturer
    Available at Addgene (#1764)
  • Backbone size w/o insert (bp) 5169
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP
  • Species
    H. sapiens (human)
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBABE 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABE YAP1 was a gift from Joan Brugge (Addgene plasmid # 15682 ; http://n2t.net/addgene:15682 ; RRID:Addgene_15682)
  • For your References section:

    Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, Sgroi DC, Deng CX, Brugge JS, Haber DA. Proc Natl Acad Sci U S A. 2006 Aug 15. 103(33):12405-10. 10.1073/pnas.0605579103 PubMed 16894141