-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepRetrosuper
- Backbone size w/o insert (bp) 6400
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP28 shRNA
-
Alt nameUSP28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)64
-
Entrez GeneUSP28
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII? (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer H1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hairpin targets the sequence: GTATGGACAAGAGCGTTGGT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRetrosuper USP28 shRNA-3 was a gift from Martin Eilers (Addgene plasmid # 15664 ; http://n2t.net/addgene:15664 ; RRID:Addgene_15664) -
For your References section:
The ubiquitin-specific protease USP28 is required for MYC stability. Popov N, Wanzel M, Madiredjo M, Zhang D, Beijersbergen R, Bernards R, Moll R, Elledge SJ, Eilers M. Nat Cell Biol. 2007 Jul . 9(7):765-74. 10.1038/ncb1601 PubMed 17558397