Skip to main content
Addgene

pFUSE-rIgG-Fc2-ICAM1
(Plasmid #156462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156462 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUSE
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 4179
  • Total vector size (bp) 5539
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Intercellular Adhesion Molecule 1
  • Alt name
    ICAM1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1387
  • Mutation
    endogenous signal peptide replaced with IL2 signal sequence; membrane domain replaced with rabbit IgG Fc, P66S and L234P in ICAM (based on open reading frame) - please see depositor comments
  • Entrez Gene
    Icam1 (a.k.a. CD54, Icam-1, Ly-47, MALA-2)
  • Promoter hEF1-HTLC
  • Tag / Fusion Protein
    • ICAM1-rFc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer tgtcacgaattcgcaggtatccatccatcccagagaag
  • 3′ sequencing primer atgcagatctgttattttgagagtggtacagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms P66S and L234P mutations does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUSE-rIgG-Fc2-ICAM1 was a gift from Dirk Mielenz (Addgene plasmid # 156462 ; http://n2t.net/addgene:156462 ; RRID:Addgene_156462)
  • For your References section:

    B Cell Speed and B-FDC Contacts in Germinal Centers Determine Plasma Cell Output via Swiprosin-1/EFhd2. Reimer D, Meyer-Hermann M, Rakhymzhan A, Steinmetz T, Tripal P, Thomas J, Boettcher M, Mougiakakos D, Schulz SR, Urbanczyk S, Hauser AE, Niesner RA, Mielenz D. Cell Rep. 2020 Aug 11;32(6):108030. doi: 10.1016/j.celrep.2020.108030. 10.1016/j.celrep.2020.108030 PubMed 32783949