T7 promoter + rpsL reporter plasmid
(Plasmid #156455)

• Purpose: A mutational reporter plasmid that can gain Streptomycin and/or Tetracycline resistance upon mutation. Contains T7 promoter.
• Depositing Lab: Matthew D. Shoulders
• Publication: Moore et al J Am Chem Soc. 2018 Sep 19;140(37):11560-11564. doi: 10.1021/jacs.8b04001. Epub 2018 Jul 18.

Backbone

• Vector backbone: BAC
• Backbone size w/o insert (bp): 4732
• Total vector size (bp): 8401
• Modifications to backbone: Chloramphenicol resistance marker replaced with ampicillin resistance marker.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: rpsL
• Species: Escherichia coli
• Insert Size (bp): 375
• Promoter: tac

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: GTGCACCCAACTGATCTTCA

Gene/Insert 2

• Gene/Insert name: TcR
• Alt name: TetA
• Species: Tn10
• Insert Size (bp): 1203
• Mutation: ATG start codon mutated to ACG
• Promoter: tet

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BclI (destroyed during cloning)
• 5′ sequencing primer: actggcatgataaggccaatcc

Resource Information

• Supplemental Documents:
  • T7 promoter + rpsL reporter plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: psc101

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.