pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct
(Plasmid
#156433)
-
PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct.
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSORORIN, AID
-
Alt nameCDC5A
-
SpeciesM. musculus (mouse)
-
Mutationnone
-
Entrez GeneCdca5 (a.k.a. 2610036L13Rik, AL024086, AW536684, C85404)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct was a gift from Elphege Nora (Addgene plasmid # 156433 ; http://n2t.net/addgene:156433 ; RRID:Addgene_156433) -
For your References section:
Molecular basis of CTCF binding polarity in genome folding. Nora EP, Caccianini L, Fudenberg G, So K, Kameswaran V, Nagle A, Uebersohn A, Hajj B, Saux AL, Coulon A, Mirny LA, Pollard KS, Dahan M, Bruneau BG. Nat Commun. 2020 Nov 5;11(1):5612. doi: 10.1038/s41467-020-19283-x. 10.1038/s41467-020-19283-x PubMed 33154377