inhibin-DsRed
(Plasmid #156184)

• Purpose: Expression plasmid for production of transgenic rainbow trout strain carrying the DsRed gene under control of the inhibin α promoter.
• Depositing Lab: Goro Yoshizaki
• Publication: Iwasaki-Takahashi et al Commun Biol. 2020 Jun 15;3(1):308. doi: 10.1038/s42003-020-1025-y.

Backbone

• Vector backbone: pDsRed2-1
• Backbone manufacturer: Clontech Laboratories Inc.
• Backbone size w/o insert (bp): 4107
• Total vector size (bp): 6836
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: rainbow trout inhibin α promoter
• Species: Oncorhynchus mykiss
• Insert Size (bp): 2113
• Promoter: inhibin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindⅢ (destroyed during cloning)
• 3′ cloning site: BamHⅠ (not destroyed)
• 5′ sequencing primer: aagtatttggtgaacaaca
• 3′ sequencing primer: ccagtctgcatggttcagat

Gene/Insert 2

• Gene/Insert name: rainbow trout β actin 3'UTR
• Species: Oncorhynchus mykiss
• Insert Size (bp): 652
• GenBank ID: AJ438158

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotⅠ (destroyed during cloning)
• 3′ cloning site: NotⅠ (destroyed during cloning)
• 5′ sequencing primer: cacctgttcctgtagcggcctaaacagactgtacc
• 3′ sequencing primer: tatgatctagtgtcgcggcctttattgggagttta

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry