Skip to main content
Addgene

pLenti-PGK-RAP1A-WT-neo
(Plasmid #156173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti PGK Neo DEST (w531-1)
  • Backbone manufacturer
    Campeau lab (addgene #19067)
  • Backbone size w/o insert (bp) 9778
  • Total vector size (bp) 8730
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAP1A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • Mutation
    wild type form
  • GenBank ID
    NM_001291896
  • Entrez Gene
    RAP1A (a.k.a. C21KG, G-22K, KREV-1, KREV1, RAP1, SMGP21)
  • Promoter human PGK
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer PGK_F (GTGTTCCGCATTCTGCAAG)
  • 3′ sequencing primer WPRE_R (CATAGCGTAAAAGGAGCAACA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

RAP1A cDNA was amplified by PCR and cloned into pENTR DTOPO and transferred by Gateway cloning into Desination vector. bioRxiv 10.1101/792077

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-RAP1A-WT-neo was a gift from Roland Friedel (Addgene plasmid # 156173 ; http://n2t.net/addgene:156173 ; RRID:Addgene_156173)
  • For your References section:

    Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052