Skip to main content
Addgene

FIP1L1
(Plasmid #155605)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155605 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    E2.pEF5-DEST-FL-V5-MCP
  • Backbone size w/o insert (bp) 7357
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FIP1L1
  • Alt name
    Accession: AL136910
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1560
  • Mutation
    none
  • Entrez Gene
    FIP1L1 (a.k.a. FIP1, Rhe, hFip1)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • V5-MCP (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer gctcgagtctagagggc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    DNASU Plasmid Repository Center for Personalized Diagnostics Biodesign Institute

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FIP1L1 was a gift from Eugene Yeo (Addgene plasmid # 155605 ; http://n2t.net/addgene:155605 ; RRID:Addgene_155605)
  • For your References section:

    Large-scale tethered function assays identify factors that regulate mRNA stability and translation. Luo EC, Nathanson JL, Tan FE, Schwartz JL, Schmok JC, Shankar A, Markmiller S, Yee BA, Sathe S, Pratt GA, Scaletta DB, Ha Y, Hill DE, Aigner S, Yeo GW. Nat Struct Mol Biol. 2020 Oct;27(10):989-1000. doi: 10.1038/s41594-020-0477-6. Epub 2020 Aug 17. 10.1038/s41594-020-0477-6 PubMed 32807991