lenti SYN-dCas9-KRAB-MeCP2
(Plasmid #155365)

• Purpose: Expresses dCas9-KRAB-MeCP2 fusion driven by human SYN promoter
• Depositing Lab: Jeremy Day
• Publication: Duke et al Front Genome Ed. 2020 Sep 15;2:9. doi: 10.3389/fgeed.2020.00009. eCollection 2020.

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Feng Zhang Addgene plasmid #52961
• Backbone size w/o insert (bp): 7958
• Total vector size (bp): 13451
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-KRAB-MeCP2
• Species: Synthetic
• Insert Size (bp): 5445
• Promoter: SYN
• Tags / Fusion Proteins:
  • 3x FLAG (N terminal on insert)
  • 7x His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCGACCGGAAGAGGTACAC

Resource Information

• Supplemental Documents:
  • Snapgene file
• A portion of this plasmid was derived from a plasmid made by: dCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Full cloning information and validation can be found in preprint on BioRxiv. doi: https://doi.org/10.1101/2020.05.26.116822
https://www.biorxiv.org/content/10.1101/2020.05.26.116822v1