Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CRY2olig-BFP-YTHDF1(D401N)-C
(Plasmid #155354)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155354 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUGW-CRY2olig-BFP
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YTHDF1(264-559)
  • Species
    H. sapiens (human)
  • Mutation
    D401N

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer UBC: GTGAGGCGTCAGTTTCTTTG
  • 3′ sequencing primer CGGAAAGGAGCTGACAGGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRY2olig-BFP-YTHDF1(D401N)-C was a gift from Xiaowei Zhuang (Addgene plasmid # 155354 ; http://n2t.net/addgene:155354 ; RRID:Addgene_155354)
  • For your References section:

    m(6)A-binding YTHDF proteins promote stress granule formation. Fu Y, Zhuang X. Nat Chem Biol. 2020 May 25. pii: 10.1038/s41589-020-0524-y. doi: 10.1038/s41589-020-0524-y. 10.1038/s41589-020-0524-y PubMed 32451507