SZ_EC_02
(Plasmid #155341)

• Purpose: Overexpression of xylose utilization genes of Yarrowia lipolytica using EasyCloneYALI. Cut with NotI to linearize repair fragment for C3 locus, overexpressing XK, XDH, and XR
• Depositing Lab: Jens Nielsen
• Publication: Konzock et al BMC Microbiol. 2021 Mar 8;21(1):77. doi: 10.1186/s12866-021-02126-0.

Backbone

• Vector backbone: pCfB6630
• Backbone size w/o insert (bp): 2833
• Total vector size (bp): 11624
• Vector type: Yeast Expression ; EasyCloneYALI insert vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: tef1 promoter - xylulose kinase - pex20 terminator
• Alt name: XK
• Alt name: YALI1_F14583g
• Alt name: YALI0E12463p
• Species: Yarrowia lipolytica
• Insert Size (bp): 2360
• Promoter: tef1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGCAACTAACATGAATGAATACG
• 3′ sequencing primer: ATCGCagagaccgggttggc

Gene/Insert 2

• Gene/Insert name: pyk1 promoter - xylose reductase - pex16 terminator
• Alt name: XR
• Alt name: YALI1_D09870g
• Species: Yarrowia lipolytica
• Insert Size (bp): 2387
• Promoter: pyk1

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aagcttcgagaagcccgaac
• 3′ sequencing primer: tgcgcgcttctgttgtttgc

Gene/Insert 3

• Gene/Insert name: gapdh promoter - xylitol dehydrogenase - lip2 terminator
• Alt name: XDH
• Alt name: YALI1_E15452g
• Species: Yarrowia lipolytica
• Insert Size (bp): 3024
• Promoter: gapdh

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggttgaaatgaatcggccgac
• 3′ sequencing primer: ggttgaaatgaatcggccgac

Resource Information

• Supplemental Documents:
  • Genbank Annotation for SZ_EC_02

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are a few differences between the Addgene NGS result and depositor's sequence. These discrepancies do not affect plasmid function.