Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pROF441
(Plasmid #155336)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155336 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDGB1alpha2
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LB_PAtU6-26-gRNA(PAtAP1)-sgRNA_RB
  • gRNA/shRNA sequence
    A. thaliana APETALA1 promoter (PAtAP1)
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer caacctctcgggcttctgga
  • 3′ sequencing primer pBR322ori-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROF441 was a gift from Matias Zurbriggen (Addgene plasmid # 155336 ; http://n2t.net/addgene:155336 ; RRID:Addgene_155336)
  • For your References section:

    Optogenetic control of gene expression in plants in the presence of ambient white light. Ochoa-Fernandez R, Abel NB, Wieland FG, Schlegel J, Koch LA, Miller JB, Engesser R, Giuriani G, Brandl SM, Timmer J, Weber W, Ott T, Simon R, Zurbriggen MD. Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29. 10.1038/s41592-020-0868-y PubMed 32601426