Skip to main content
Addgene

pROF402
(Plasmid #155334)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155334 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDGB1alpha2
  • Vector type
    Luciferase, Synthetic Biology ; Eukaryotic Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The operator repetitions can be lost after bacterial propagation. It is recommended to grow the bacteria at 30°C and sequence the repeats after new DNA preparations.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LB_P35Senhancer(-953 to -51)-(C120)5-PhCMVmin-FLuc-T35S_RB
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer caacctctcgggcttctgga
  • 3′ sequencing primer pBR322ori-F
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified an IS4 element that the depositing lab does not believe to be of functional concern. Requesting scientists should validate expected functionality prior to to experimental use.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROF402 was a gift from Matias Zurbriggen (Addgene plasmid # 155334 ; http://n2t.net/addgene:155334 ; RRID:Addgene_155334)

  • For your References section:

    Optogenetic control of gene expression in plants in the presence of ambient white light. Ochoa-Fernandez R, Abel NB, Wieland FG, Schlegel J, Koch LA, Miller JB, Engesser R, Giuriani G, Brandl SM, Timmer J, Weber W, Ott T, Simon R, Zurbriggen MD. Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29. 10.1038/s41592-020-0868-y PubMed 32601426
Related items:
Commonly requested with: