pROF148
(Plasmid
#155330)
-
PurposeBinary vector for expression of the PULSE system under the control of AtUbi10 promoter. It contains a plant selection cassette.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB1alpha2
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLB_Tnos-nptII-Pnos_PAtUbi10-SRDX-NLS-EL222-Tnos_PAtUbi10-E-PIF6-NLS-Tnos_PAtUbi10-PhyB-VP16-NLS-Tnos_RB
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga
- 3′ sequencing primer pBR322ori-F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROF148 was a gift from Matias Zurbriggen (Addgene plasmid # 155330 ; http://n2t.net/addgene:155330 ; RRID:Addgene_155330) -
For your References section:
Optogenetic control of gene expression in plants in the presence of ambient white light. Ochoa-Fernandez R, Abel NB, Wieland FG, Schlegel J, Koch LA, Miller JB, Engesser R, Giuriani G, Brandl SM, Timmer J, Weber W, Ott T, Simon R, Zurbriggen MD. Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29. 10.1038/s41592-020-0868-y PubMed 32601426