pNBA002
(Plasmid #155324)

• Purpose: Binary vector for expression of PULSE-controlled GBP-mCherry
• Depositing Lab: Matias Zurbriggen
• Publication: Ochoa-Fernandez et al Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29.

Backbone

• Vector backbone: Xpre2-S
• Vector type: Synthetic Biology ; Eukaryotic Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: The operator repetitions can be lost after bacterial propagation. It is recommended to grow the bacteria at 30°C and sequence the repeats after new DNA preparations.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LB_(etr)8-(C120)5-PhCMVmin-GBP-mCherry-T35S_RB
• Species: Synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: ctgcctgtatcgagtggtga

Resource Information

• Supplemental Documents:
  • pNBA002.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry