Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ5079_pHR_PGK_sfGFP_CoV-F1
(Plasmid #155303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155303 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 8965
  • Total vector size (bp) 11682
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Superfolder GFP fused with SARS-CoV-F1
  • Alt name
    SFGFP
  • Alt name
    SARS-CoV-F1
  • Species
    Synthetic
  • Insert Size (bp)
    2717
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATTCTGCACGCTTCAAAAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5079_pHR_PGK_sfGFP_CoV-F1 was a gift from Stanley Qi (Addgene plasmid # 155303 ; http://n2t.net/addgene:155303 ; RRID:Addgene_155303)
  • For your References section:

    Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252