Dox nontargeting shRNA mKate
(Plasmid
#155292)
-
PurposeLentivirus for doxycycline inducible expression of nontargeting shRNA, mKate marker, based on Addgene 11652
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene #11652
-
Modifications to backboneStandard non-targeting shRNA inserted into Addgene #11652 (example PMID: 23292955 has nontargeting sequence) mKate replaces GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNontargeting shRNA
-
gRNA/shRNA sequenceTCTCGCTTGGGCGAGAGTAAG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dox nontargeting shRNA mKate was a gift from Martin Carroll (Addgene plasmid # 155292 ; http://n2t.net/addgene:155292 ; RRID:Addgene_155292)