Lentiviral nontargeting shRNA GFP
(Plasmid
#155285)
-
PurposeLentiviral expression of nontargeting shRNA, GFP expression, based on Addgene 12247
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneAddgene #12247
-
Modifications to backboneStandard non-targeting shRNA inserted into Addgene #12247 (example PMID: 23292955 has nontargeting sequence)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNontargeting shRNA
-
gRNA/shRNA sequenceTCTCGCTTGGGCGAGAGTAAG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lentiviral nontargeting shRNA GFP was a gift from Martin Carroll (Addgene plasmid # 155285 ; http://n2t.net/addgene:155285 ; RRID:Addgene_155285)
