Skip to main content
Addgene

Lentiviral nontargeting shRNA GFP
(Plasmid #155285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene #12247
  • Modifications to backbone
    Standard non-targeting shRNA inserted into Addgene #12247 (example PMID: 23292955 has nontargeting sequence)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nontargeting shRNA
  • gRNA/shRNA sequence
    TCTCGCTTGGGCGAGAGTAAG

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lentiviral nontargeting shRNA GFP was a gift from Martin Carroll (Addgene plasmid # 155285 ; http://n2t.net/addgene:155285 ; RRID:Addgene_155285)