Cas9 ROSA sgRNA mCherry
(Plasmid #155280)

• Purpose: Lentiviral Cas9 expression, ROSA sgRNA expression, mCherry marker
• Depositing Lab: Martin Carroll
• Publication: Lenitviral sgRNA and Cas9 constructs (unpublished)

Backbone

• Vector backbone: Addgene #99154
• Modifications to backbone: Insert ROSA sgRNA at BsmB1 sites. Sequence of sgRNA is GAAGATGGGCGGGAGTCTTC with appropriate overhangs. To be used with reporter constructs 155282 and 155283

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: spCas9

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry