3xHA-TurboID pRetrox
(Plasmid #155203)

• Purpose: For doxycycline-inducible expression of 3xHA-TurboID on N-terminus of bait protein
• Depositing Lab: Kyle Roux
• Publication: May et al Cells. 2020 Apr 25;9(5). pii: cells9051070. doi: 10.3390/cells9051070.

Backbone

• Vector backbone: pRetroX-Tight-Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6541
• Total vector size (bp): 7603
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 3xHA-TurboID
• Alt name: TurboID
• Species: Synthetic
• Insert Size (bp): 1062
• Promoter: tight TRE promotor
• Tag / Fusion Protein:
  • 3xHA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NaeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAGAAGCTGGATAACTTC
• 3′ sequencing primer: CAGAGGCCACTTGTGTAGCGCCA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid 107171

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry