pAAV.CMV.SV40.THBS1-deltaCC-HA.SV40(polyA)
(Plasmid #155195)

• Purpose: Expresses murine Thrombospondin-1 (THBS1) protein with deletion of Coiled Coil domain and HA-tag at C-terminus
• Depositing Lab: Kevin Park
• Publication: Bray et al Neuron. 2019 Aug 21;103(4):642-657.e7. doi: 10.1016/j.neuron.2019.05.044. Epub 2019 Jun 26.

Backbone

• Vector backbone: Modified pAAV-MCS
• Backbone size w/o insert (bp): 3601
• Total vector size (bp): 7030
• Modifications to backbone: Truncated CMV enhancer sequence; beta-Globine intron replaced with SV40 intron; hGH polyA signal replaced with SV40 polyA signal
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Thrombospondin-1
• Alt name: THBS1
• Species: M. musculus (mouse)
• Insert Size (bp): 3429
• Mutation: THBS1 with deletion of amino acid residues 276-315
• Entrez Gene: Thbs1 (a.k.a. TSP-1, TSP1, Thbs-1, tbsp1)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTCCCCCTGAACCTGAAAC

Resource Information

• Supplemental Documents:
  • pAAV.CMV.SV40.THBS1-delta-CC-HA.SV40.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry