Skip to main content
Addgene

XLone-Puro beta-catenin P2A eGFP-NLS
(Plasmid #155189)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155189 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Addgene #154399
  • Backbone size w/o insert (bp) 6614
  • Total vector size (bp) 8909
  • Vector type
    Mammalian Expression, Unspecified ; Piggybac transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    beta-catenin
  • Alt name
    Ctnnb1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2343
  • Mutation
    Sites phosphorylated by GSK-3beta have been mutated, S33A, S37A, T41A, S45A
  • GenBank ID
    NM_007614
  • Entrez Gene
    Ctnnb1 (a.k.a. Bfc, Catnb, Mesc)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • P2A eGFP NLS (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI, SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer M13 FWD
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The beta-catenin sequence was PCR amplified from E[beta]P, a gift from Roel Nusse (Addgene #24313)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-Puro beta-catenin P2A eGFP-NLS was a gift from Xiaoping Bao (Addgene plasmid # 155189 ; http://n2t.net/addgene:155189 ; RRID:Addgene_155189)

  • For your References section:

    Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999
Related items:
Commonly requested with: